Redirection

Overview

Teaching: 30 min
Exercises: 15 min
Questions
  • How can I search within files?

  • How can I combine existing commands to do new things?

Objectives
  • Employ the grep command to search for information within files.

  • Print the results of a command to a file.

  • Construct command pipelines with two or more stages.

Searching files

We discussed in a previous episode how to search within a file using less. We can also search within files without even opening them, using grep. grep is a command-line utility for searching plain-text files for lines matching a specific set of characters (sometimes called a string) or a particular pattern (which can be specified using something called regular expressions). We’re not going to work with regular expressions in this lesson, and are instead going to specify the strings we are searching for. Let’s give it a try!

Nucleotide abbreviations

The four nucleotides that appear in DNA are abbreviated A, C, T and G. Unknown nucleotides are represented with the letter N. An N appearing in a sequencing file represents a position where the sequencing machine was not able to confidently determine the nucleotide in that position. You can think of an N as being aNy nucleotide at that position in the DNA sequence.

We’ll search for strings inside of our fastq files. Let’s first make sure we are in the correct directory:

$ cd ~/shell_data/untrimmed_fastq

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).

Determining quality

In this lesson, we’re going to be manually searching for strings of Ns within our sequence results to illustrate some principles of file searching. It can be really useful to do this type of searching to get a feel for the quality of your sequencing results, however, in your research you will most likely use a bioinformatics tool that has a built-in program for filtering out low-quality reads. You’ll learn how to use one such tool in a later lesson.

Let’s search for the string NNNNNNNNNN in the SRR098026 file:

$ grep NNNNNNNNNN SRR098026.fastq

This command returns a lot of output to the terminal. Every single line in the SRR098026 file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is. We may be interested not only in the actual sequence which contains this string, but in the name (or identifier) of that sequence. We discussed in a previous lesson that the identifier line immediately precedes the nucleotide sequence for each read in a FASTQ file. We may also want to inspect the quality scores associated with each of these reads. To get all of this information, we will return the line immediately before each match and the two lines immediately after each match.

We can use the -B argument for grep to return a specific number of lines before each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each matching line, so we add -B1 -A2 to our grep command:

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq

One of the sets of lines returned by this command is:

@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Exercise 04.01

  1. Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  2. Search for the sequence AAGTT in both FASTQ files. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

Solution

  1. grep -B1 GNATNACCACTTCC SRR098026.fastq

     @SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
     GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
    
  2. grep -B1 AAGTT *.fastq

    SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
    SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
    --
    SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
    SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
    --
    SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
    SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
    --
    SRR097977.fastq-@SRR097977.80 209DTAAXX_Lenski2_1_7:8:3:258:281 length=36
    SRR097977.fastq:GTGGCGCTGCTGCATAAGTTGGGTTATCAGGTCGTT
    --
    SRR097977.fastq-@SRR097977.92 209DTAAXX_Lenski2_1_7:8:3:353:318 length=36
    SRR097977.fastq:GGCAAAATGGTCCTCCAGCCAGGCCAGAAGCAAGTT
    --
    SRR097977.fastq-@SRR097977.139 209DTAAXX_Lenski2_1_7:8:3:703:655 length=36
    SRR097977.fastq:TTTATTTGTAAAGTTTTGTTGAAATAAGGGTTGTAA
    --
    SRR097977.fastq-@SRR097977.238 209DTAAXX_Lenski2_1_7:8:3:592:919 length=36
    SRR097977.fastq:TTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGAT
    --
    SRR098026.fastq-@SRR098026.158 HWUSI-EAS1599_1:2:1:1:1505 length=35
    SRR098026.fastq:GNNNNNNNNCAAAGTTGATCNNNNNNNNNTGTGCG
    

Redirecting output

grep allowed us to identify sequences in our FASTQ files that match a particular pattern. All of these sequences were printed to our terminal screen, but in order to work with these sequences and perform other operations on them, we will need to capture that output in some way.

We can do this with something called “redirection”. The idea is that we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. In our case, we want to print this information to a file so that we can look at it later and use other commands to analyze this data.

The command for redirecting output to a file is >.

Let’s try out this command and copy all the records (including all four lines of each record) in our FASTQ files that contain ‘NNNNNNNNNN’ to another file called bad_reads.txt.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt

File extensions

You might be confused about why we’re naming our output file with a .txt extension. After all, it will be holding FASTQ formatted data that we’re extracting from our FASTQ files. Won’t it also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to name it with a .fastq extension. However, using a .fastq extension will lead us to problems when we move to using wildcards later in this episode. We’ll point out where this becomes important. For now, it’s good that you’re thinking about file extensions!

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should see a new file called bad_reads.txt.

We can check the number of lines in our new file using a command called wc. wc stands for word count. This command counts the number of words, lines, and characters in a file.

$ wc bad_reads.txt
  537    1073   23217 bad_reads.txt

This will tell us the number of lines, words and characters in the file. If we want only the number of lines, we can use the -l flag for lines.

$ wc -l bad_reads.txt
537 bad_reads.txt

Exercise 04.02

How many sequences are there in SRR098026.fastq? Remember that every sequence is formed by four lines.

Solution

$ wc -l SRR098026.fastq
996

Now you can divide this number by four to get the number of sequences in your fastq file

Exercise 04.03

How many sequences in SRR098026.fastq contain at least 3 consecutive Ns?

Solution

$ grep NNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
249

We might want to search multiple FASTQ files for sequences that match our search pattern. However, we need to be careful, because each time we use the > command to redirect output to a file, the new output will replace the output that was already present in the file. This is called “overwriting” and, just like you don’t want to overwrite your video recording of your kid’s first birthday party, you also want to avoid overwriting your data files.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
$ wc -l bad_reads.txt
0 bad_reads.txt

Here, the output of our second call to wc shows that we no longer have any lines in our bad_reads.txt file. This is because the second file we searched (SRR097977.fastq) does not contain any lines that match our search sequence. So our file was overwritten and is now empty.

We can avoid overwriting our files by using the command >>. >> is known as the “append redirect” and will append new output to the end of a file, rather than overwriting it.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

The output of our second call to wc shows that we have not overwritten our original data.

We can also do this with a single line of code by using a wildcard:

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

File extensions - part 2

This is where we would have trouble if we were naming our output file with a .fastq extension. If we already had a file called bad_reads.fastq (from our previous grep practice) and then ran the command above using a .fastq extension instead of a .txt extension, grep would give us a warning.

grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq
grep: input file ‘bad_reads.fastq’ is also the output

grep is letting you know that the output file bad_reads.fastq is also included in your grep call because it matches the *.fastq pattern. Be careful with this as it can lead to some unintended results.

Since we might have multiple different criteria we want to search for, creating a new output file each time has the potential to clutter up our workspace. We also thus far haven’t been interested in the actual contents of those files, only in the number of reads that we’ve found. We created the files to store the reads and then counted the lines in the file to see how many reads matched our criteria. There’s a way to do this, however, that doesn’t require us to create these intermediate files - the pipe command (|).

This is probably not a key on your keyboard you use very much, so let’s all take a minute to find that key. For the standard QWERTY keyboard layout, the | character can be found using the key combination

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. When our output was scrolling by, we might have wished we could slow it down and look at it, like we can with less. Well it turns out that we can! We can redirect our output from our grep call through the less command.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less

We can now see the output from our grep call within the less interface. We can use the up and down arrows to scroll through the output and use q to exit less.

If we don’t want to create a file before counting lines of output from our grep search, we could directly pipe the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure you would like to save it to a file.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l 

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by four to get the number of sequences that match our search pattern. Since 537 / 4 = 134.5 and we are expecting an integer number of records, there is something added or missing in bad_reads.txt. If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ tail bad_reads.txt
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
--
--
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The fifth and six lines in the output display “–” which is the default action for grep to separate groups of lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.fastq
tail bad_reads.fastq
+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The -v option in the second grep search stands for --invert-match meaning grep will now only display the lines which do not match the searched pattern, in this case '^--'. The caret (^) is an anchoring character matching the beginning of the line, and the pattern has to be enclose by single quotes so grep does not interpret the pattern as an extended option (starting with –).

Custom grep control

Use man grep to read more about other options to customize the output of grep including extended options, anchoring characters, and much more.

Redirecting output is often not intuitive, and can take some time to get used to. Once you’re comfortable with redirection, however, you’ll be able to combine any number of commands to do all sorts of exciting things with your data!

None of the command line programs we’ve been learning do anything all that impressive on their own, but when you start chaining them together, you can do some really powerful things very efficiently.

File manipulation and more practices with pipes

To practice a bit more with the tools we’ve added to our tool kit so far and learn a few extra ones you can follow this extra lesson which uses the SRA metadata file.

For further automation e.g. processing multiple files, we can use for loops and the basename command - see this Extra lesson

Key Points

  • grep is a powerful search tool with many options for customization.

  • >, >>, and | are different ways of redirecting output.

  • command > file redirects a command’s output to a file.

  • command >> file redirects a command’s output to a file without overwriting the existing contents of the file.

  • command_1 | command_2 redirects the output of the first command as input to the second command.